Title of article
Energetic basis of molecular recognition in a DNA aptamer Original Research Article
Author/Authors
G. Reid Bishop، نويسنده , , Jinsong Ren، نويسنده , , Brandon C. Polander، نويسنده , , Benjamin D. Jeanfreau، نويسنده , , John O. Trent، نويسنده , , Jonathan B. Chaires، نويسنده ,
Issue Information
روزنامه با شماره پیاپی سال 2007
Pages
11
From page
165
To page
175
Abstract
The thermal stability and ligand binding properties of the l-argininamide-binding DNA aptamer (5′–GATCGAAACGTAGCGCCTTCGATC–3′) were studied by spectroscopic and calorimetric methods. Differential calorimetric studies showed that the uncomplexed aptamer melted in a two-state reaction with a melting temperature Tm = 50.2 ± 0.2 °C and a folding enthalpy ΔH°fold = − 49.0 ± 2.1 kcal mol− 1. These values agree with values of Tm = 49.6 °C and ΔH°fold = − 51.2 kcal mol− 1 predicted for a simple hairpin structure. Melting of the uncomplexed aptamer was dependent upon salt concentration, but independent of strand concentration. The Tm of aptamer melting was found to increase as l-argininamide concentrations increased. Analysis of circular dichroism titration data using a single-site binding model resulted in the determination of a binding free energy ΔG°bind = − 5.1 kcal mol− 1. Isothermal titration calorimetry studies revealed an exothermic binding reaction with ΔH°bind = − 8.7 kcal mol− 1. Combination of enthalpy and free energy produce an unfavorable entropy of − TΔS° = + 3.6 kcal mol− 1. A molar heat capacity change of − 116 cal mol− 1 K− 1 was determined from calorimetric measurements at four temperatures over the range of 15–40 °C. Molecular dynamics simulations were used to explore the structures of the unligated and ligated aptamer structures. From the calculated changes in solvent accessible surface areas of these structures a molar heat capacity change of − 125 cal mol− 1 K− 1 was calculated, a value in excellent agreement with the experimental value. The thermodynamic signature, along with the coupled CD spectral changes, suggest that the binding of l-argininamide to its DNA aptamer is an induced-fit process in which the binding of the ligand is thermodynamically coupled to a conformational ordering of the nucleic acid.
Keywords
molecular recognition , DNA , Aptamer , thermodynamics , Entropy , Enthalpy , Calorimetry , circular dichroism , Induced fit
Journal title
Biophysical Chemistry
Serial Year
2007
Journal title
Biophysical Chemistry
Record number
1119843
Link To Document