Title of article
First Case of Imported Plasmodium Ovale from Iran
Author/Authors
Jamshidi Makiani, Mahin infectious Diseases Research Center , Nateghpour, Mehdi School of Public Health - Tehran University of Medical Sciences - Tehran , Mohseni, Gholam Hormozgan Health Center - Hormozgan University of Medical Sciences - Hormozgan, , Safari, Reza Hormozgan Health Center - Hormozgan University of Medical Sciences - Hormozgan, , Hajjaran, Homa School of Public Health - Tehran University of Medical Sciences - Tehran , Ataei, Saeideh School of Public Health - Tehran University of Medical Sciences - Tehran
Pages
2
From page
264
To page
265
Abstract
Malaria is one of the most important vector-borne parasitic diseases in the world, particularly in tropical
and subtropical areas.1,2 It is caused by one, or rarely more than one, of four plasmodia species namely,
Plasmodium vivax, P. falciparum, P. malariae and P. ovale. Plasmodium ovale has a pattern of fever
and relapse similar to that of P. vivax, but generally milder clinical symptoms,3 Plasmodium ovale
is mostly limited to tropical Africa and Southeast Asia,4-6 with a prevalence of 10-15% and 2.0-9.4%,
respectively.7 Iran is an endemic region for malaria in the Middle East with P. vivax, P. falciparum, and
rarely P. malariae infections. Herein the first authentic imported case of Plasmodium oval in Iran is
reported.
A twenty years old Nigerian soccer player was referred to a Health Centre in Bandar Abbas, Iran
with fever (38.5°C) chills, anorexia and bone pain. The patient had arrived in Iran, and resided in
Bandar Abbas one month before the onset of clinical symptoms. The vital signs were within normal
range and the laboratory analysis of his blood showed, a platelet count of 136000. His abdomen was
soft without organomegaly and his urine analysis was also normal. The patient stated that he had a
history of malaria almost the year before in Nigeria, and had been treated. However, he could not
remember the type of malaria and the treatment he received.
Standard Giemsa–stained thick and thin blood smears from finger-pricked blood samples were
made, and microscopically examined. Typical trophozaites of P. ovale were detected. In thin films,
many erythrocytes were slightly enlarged assuming an oval shape with ragged margins and heavy
stippling. To further characterize the parasite genus, a molecular genomic sequencing technique was
employed. Blood samples scratched from non-stained smears were used to extract the total genomic
DNA using Qiagen kit (QIAamp DAN Blood).8 The fragments of 18 ssrRNA with a band of 787 bp was
amplified using PLF (Forward; 5’: agtgtatatcaatcgagttte 3’) and UNR (Reverse; gacggtatctgatggtettc)
primers,9 (figure 1). The amplified product in unit 700 bp was sequenced at SEQLAB, Germany (Germany;
http://www.seqsondemand.de) to confirm the species of Plasmodium ovale. Nucleotide sequence
data were registered in the GenBank database with the accession no. GQ397481.
The patient received standard treatment with 1 g chloroquine phosphate (600 mg base) orally for
two days followed by 500 mg chloroquine phosphate (300 mg base) on the third day. (Chloroquine
tablets were 250 mg with 150 mg base). Administered dosage was 10 mg/kg on first and second day
of treatment and 5 mg/kg on the third day. Primaquine was administered to prevent relapse with a dosage
of 45 mg weekly (0.75 mg/kg/week) for 8 weeks (Primaquine tablets were 26.3 mg with 15 mg
base). All people in near contact with the patient were examined for likely malaria infection. The pa-
Keywords
Imported , Plasmodium
Journal title
Astroparticle Physics
Serial Year
2010
Record number
2417051
Link To Document