Title of article
Novel insertion and deletion mutations in the 5′-UTR of the folate receptor-α gene: an additional contributor to hyperhomocysteinemia?
Author/Authors
Torbj?rn K. Nilsson، نويسنده , , Anna K. B?rjel، نويسنده ,
Issue Information
روزنامه با شماره پیاپی سال 2004
Pages
6
From page
224
To page
229
Abstract
Objectives: To search for mutations in the 5′-UTR and proximal promoter region of the folate receptor-α (FR-α) gene, whose exons are known to be virtually free of genetic variation in the population.
Design and mthods: Seven hundred seventy-eight patient samples were screened for mutations between nt −116 and nt +207 in the FR-α gene using single strand conformation polymorphism (SSCP) followed by DNA sequencing.
Results: Three patients were found to have a 25-bp deletion, c.109_133delCCACTAAACCACAGCTGTCCCCTGG, and three others had a 1-bp A insertion, c.-69dupA, so that 0.77% of the patient population showed genetic variation already in the 323 bp promoter sequence studied so far.
Conclusions: The promoter region of FR-α may harbor much more genetic variation than its highly conserved exons, and not just isolated, unique mutations. This could be a new factor contributing to gene–food interaction explaining part of the hyperhomocysteinemia panorama. Extended searches for polymorphisms further upstream in the FR-α gene are warranted.
Keywords
homocysteine , folate , hyperhomocysteinemia , DNA sequencing , deletion , insertion , Folate receptor , Mutation screening , Promoter region , Single strandconformation polymorphism
Journal title
Clinical Biochemistry
Serial Year
2004
Journal title
Clinical Biochemistry
Record number
482503
Link To Document