ارتباط چندشكلي ژن NPY با صفات توليد مثلي در بوقلمون هاي ايران

NPY gene polymorphisms associate with reproductive traits of turkeys in Iran

زمينه­ي مطالعاتي: نوروپپتيدY يك نوروترنسميتر در هيپوتالاموس است كه نخستين بار از هيپوتالاموس مغز خوك استخراج شد و محرك اشتها و موثر بر هورمون هاي توليدمثلي است. هدف: هدف اين مطالعه، توالي يابي و بررسي ارتباط ژن NPY با صفات توليدمثلي در بوقلمون­هاي بومي ايران است. اين صفات شامل وزن توده­ي تخم توليدي، طول دوره­ي تخم­گذاري، سن بلوغ جنسي و وزن اولين تخم مي­باشد. روش كار: 120 بوقلمون ماده به طور تصادفي از ايستگاه تحقيقات بوقلمون استان آذربايجان شرقي انتخاب شد و ركوردهاي توليد مثلي آنها ثبت شد. از نمونه ي خون بوقلمون ها براي استخراج DNAاستفاده شد. قطعه ي 725 جفت بازي ژن NPY با استفاده از پرايمرهاي طراحي شده­ي اختصاصي تكثير شد. چندشكلي ژن NPY با توالي يابي محصولات PCR بررسي شد. نتايج: 4 جايگاه چندشكليC552T ، T544A، T360G و C367A در توالي ژن NPYيافت شد. نتايج ارتباط معني داري بين جايگاه T360G با صفت وزن كل تخم نشان داد و چندشكلي A544T ارتباط معني داري با وزن تخم و طول دوره­ي تخم­گذاري داشت. نتيجه گيري نهايي: در نتيجه چندشكلي­هاي جديدي در ناحيه اينتروني ژن NPY مشخص شد كه بر صفات وزن كل تخم، تعداد تخم و طول دوره تخم‌گذاري تاثير داشت. نتايج اين پژوهش مي‌تواند در برنامه­هاي اصلاح نژادي بوقلمون‌هاي بومي شمال غرب ايران مورد توجه قرار گيرد.

ntroduction: Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg. Materials and methods: A hundred and twenty turkey hens were randomly chosen from turkey’s breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999).A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1.2 ml of each primer, 8.1 ml water and 12.5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94°C for 5 min, followed by 32 cycles of 94°C for 60 s, 56° C for 40 s, and 72°C for 45 s. A final extension step was performed at 72°C for 8 min. Electrophoresis of the amplicons was carried out on 1.5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey’s test were performed to find differences among means.