جدايه جديد Spiroplasma citri جدا شده از زنجرك Circulifer haematoceps در استان فارس

NOVEL ISOLATE OF Spiroplasma citri FROM LEAFHOPPER Circulifer haematoceps FROM FARS PROVINCE

جدايه هاي Spiroplasma citri براساس تحرك الكتروفورزي پروتيين و RFLP ژن اسپيرالين به پنج گروه تقسيم شده اند (Foissac et al. 1996). در اين گزارش دو جدايه جديد S. citri كه واجدشرايط براي پايه گذاري گروه ششم هستند معرفي مي گردد. پيش از اين آلودگي S. citri در گياه كنجد گزارش شده بود (Salehi and Izadpanah 2002). نمونه هاي زنجرك ناقل (Salehi et al.1993) آلوده بهS. citri از مناطق مختلف استان فارس جمع آوري شدند. حشرات ناقل آلوده (Circulifer haematoceps) جهت انتقال S. citri روي گياه پروانش (Catharanthus roseus) نگه داري شدند. وجود آلودگي در نمونه هاي گياهي جمع آوري شده از باغ ها و گياهاني كه توسط زنجرك ناقل و در شرايط گلخانه آلوده شده بودند با استفاده از آنتي سرم محلي كه بر عليه جدايه S. citri تهيه شده بود تاييد شد. محيط LD10(Lee and Davis 1984) جهت جداسازي بيمارگر از نمونه هاي آلوده مورد استفاده قرار گرفت. واكنش زنجيره اي پليمراز با استفاده از جفت آغازگر F1R1 (TAATTTTAATAACATTTGCTT3´,-´5 3 5-GTTCTAAATAAGAAAAAGTTT-) كه ژن اسپيرالين را تكثير مي كند انجام شد. محصول PCR در باكتري E. coli همسانه سازي وتعيين ترادف گرديد. آناليز RFLP ژن اسپيرالين نشان داد كه اكثر جدايه هاي S. ctri در گروه يك قرار مي گيرند اما دو جدايه اسپيروپلاسما كه از زنجرك Circulifer haematoceps از مزارع كنجد جدا شده بودند با هيچ يك از اين پنج گروه تطابق نداشتند. ژن اسپيرالين در هر دو جدايه (Acc. No. FJ755921 and FJ755922.) داراي 93 درصد همولوژي با جدايه GII3بود و توانايي رمزگذاري 244 آمينو اسيد را داشت. اين در حالي است كه جدايه هاي گروه يك تا چهار تعداد 241 و جدايه گروه پنج 242 آمينو اسيد را رمزگذاري مي كنند. از طرف ديگر آناليز RFLP ژن اسپيرالين نشان داد كه اين دو جدايه داراي يك جايگاه برشي اضافي با آنزيم MboIدر موقعيت نوكليوتيد شماره 456 به همراه تغيير در موقعيت ديگر جايگاه هاي برشي مي باشد. اين نتايج با الكتروفورز پروتيين در ژل آكريل آميد مورد تاييد قرار گرفت. اندازه پروتيين اسپيرالين در اين دو جدايه kDa8/22 بوددر حالي كه اندازه اين پروتيين در جدايه پالمير kDa 32 و در جدايه هاي گروه هاي يك تا چهار kDa 5/28- 24 گزارش شده است. بنابراين با توجه به داده هاي موجود (Foissac et al. 1996) اين دو جدايه را مي توان در يك گروه جداگانه (گروه شش) قرار داد.

Strains of Spiroplasma citri have been classified into five groups based on electrophoretic mobility (EM) of spiralin protein and RFLP analysis of spiralin gene (Foissac et al. 1996). In the present study, two isolates of S. citri qualifying for formation of a sixth group are reported. Infection of sesame plants by S. citri has been reported previously (Salehi and Izadpanah 2002). Samples of vector (Circulifer haematoceps) leafhoppers (Salehi et al.1993) were collected in various regions in Fars province of Iran. The insects were caged on periwinkle (Catharanthus roseus) plants. Presence of S. citri in collected plant samples and vector-inoculated plants was verified by ELISA using a locally produced polyclonal antiserum against a citrus isolate of S. citri. ELISA-positive samples were used to isolate S. citri in culture medium LD10 (Lee and Davis 1984). S. citri grown in culture was used to amplify spiralin gene by PCR using specific primer pair F1/R1 (5´ -TAATTTTAATAACATTTGCTT-3´/5-´ GTTCTAAATAAGAAAAAGTTT-3´). The amplified products were cloned in E. coli and sequenced. RFLP analysis showed that most isolates fell into group I of S. citri strains but two isolates originally obtained from C. haematoceps in a sesame field and propagated in periwinkle (Catharanthus roseus) did not match any of the five groups. The spiralin gene in both isolates (Acc. No. FJ755921 and FJ755922.) had only 93 percent homology with that of GII3 strain and could code for 244 amino acids (aa) instead of 241 aa in strains of groups 1-4 and 242 aa in a group 5 (Palmyre) strain. RFLP analysis showed that the leafhopper isolates had one additional MboI restriction site at nucleotide 456 plus changes in the position of certain other restriction sites. These results were confirmed by electrophoresis in polyacrylamide gel in which the spiralin protein from both insect isolates showed a different EM and banded at 28.8 kDa compared to 32 kDa for palmyre isolate and 24-28.5 reported for groups 1-4. By the current criteria (Foissac et al. 1996) the two new isolates qualify for forming a new group (group 6) of S. citri strains from Iran.